Categories
Uncategorized

Ethanol Molecule

The sections were washed twice for min each in PBS.The immunostain was developed with diaminobenzidine tetrahydrochloride for min.The sections were counterstained with hematoxylin, rehydrated in ethanol followed by xylene, and coverslipped.Immunohistochemical staining for iNOS was evaluated by light microscopy.Nitrite and nitrate concentrations were determined by interpolation from known standards.The human iNOS primers were sense; CCCTTTACTTGACCTCCTAAC; antisense; AAGGAATCATACAGGGAAGAC.After reverse transcription using a programmed thermocycler an initial denaturation for min at C; and. The membrane was blocked with nonfat dried milk in TTBS for h.The membrane was washed three times in TTBS for min each before applying the secondary antibody was applied at a: dilution for h.The blot was washed in TTBS four times for min each.It was then incubated in commercially enhanced chemiluminescence reagent and exposed to photographic film.The agarose was allowed to set for min at C and the slides were incubated in lysis solution. There was intense staining for iNOS in all human cholangiocarcinoma specimens.In this limited sample, no relationship was observed between tumor grade and intensity of iNOS staining. Evidence for catalytic activity of the expressed iNOS protein was identified by performing immunohistochemistry for nitrotyrosine, a reaction product of peroxynitrite with susceptible tyrosine residues.Similar to the immunohistochemistry for iNOS, all cholangiocarcinoma specimens revealed positive staining for nitrotyrosine.The presence of nitrotyrosine residues implies a high level of activity of the expressed iNOS. In comparison, the biliary epithelia from normal liver biopsies did not stain either for iNOS or nitrotyrosine.Thus, cholangiocarcinomas appear to uniformly express iNOS and stain intensely for nitrotyrosine, a marker of oxidative protein damage.The left panel represents immunostaining without primary antibody, and the right panel represents immunostaining with the primary antibody.Normal liver tissue, specifically the bile duct epithelia. Cells cultured in the absence of stimulatory cytokines failed to express iNOS. The identification of iNOS in the cholangiocarcinoma specimens but only in cytokinestimulated cholangiocarcinoma cells in vitro suggests that cholangiocarcinomas in vivo grow in a cytokinerich milieu.Therefore, we measured NO in the media of cholangiocarcinoma cells incubated in the presence and absence of stimulatory cytokines. NO generation was increased in all of the three cell lines incubated in the presence of stimulatory cytokines compared to controls.We confirmed that iNOS was the source of the NO by incubating the cells in the presence of inflammatory cytokines plus the iNOS inhibitor LNMMA. Indeed, stimulated NO production was completely suppressed by the addition of the competitive iNOS inhibitor.Thus, iNOS expressed by the cholangiocarcinoma cells is catalytically active.The control cells demonstrate compact tight nucleoids.However, the cells treated with stimulatory cytokines indicative of DNA damage.The DNA damage was blocked with the iNOS inhibitor LNMMA. These data demonstrate that the magnitude of NO generated by iNOS induction is sufficient to cause singlestrandeddoublestranded DNA damage as well as oxidative lesions.As an initial effort to assess the mechanisms of accumulative DNA damage by iNOS stimulation and NO production, we used the DNA repair incorporation assay to assess DNA repair capacity. Markedly elevated levels of NO NO were found in all stimulated cultures. The extent of DNA damage incurred by the cholangiocarcinoma cells on exposure to NO was evaluated by singlecell gel electrophoresis using the comet assay.

Leave a Reply

Your email address will not be published. Required fields are marked *